How Do I Get Tested For A Braf Mutation
If you have a tumor, your oncologist may recommend analyzing the tumors DNA to see if it has a BRAF mutation. He or she will collect a sample of the tumor tissue through a biopsy and send it to a lab for genetic testing. The test results will show if the sample is positive or negative for the BRAF mutation, as well as the specific type of mutation. Biopsies are surgeries that can be difficult to perform on certain tumors because of their location, so a biopsy may not always be possible.
If biopsy is not an option, your doctor may recommend a blood test instead. It is less invasive and quicker, but it identifies only certain types of BRAF mutations and doesnt offer as much detail as a genetic test.
A BRAF blood test could be an option if you dont have a tumor but are eligible to be tested due to family history or other risk factors that make your doctor suspicious for a BRAF mutation.
Detection Of Braf Mutation
Because the T1799A transversion mutation is virtually the only BRAF mutation that has been described in PTC with a high prevalence in previous studies, we sought this particular mutation in various subtypes of PTC in the present study. The BRAF T1799A mutation was analyzed using genomic DNA by direct sequencing and a colorimetric method using the Mutector kit as described previously . For direct DNA sequencing, exon 15 of the BRAF gene was amplified by PCR, followed by Big Dye terminator cycle sequencing reaction and sequence reading on an ABI PRISM 3730 genetic analyzer . The colorimetric method for BRAF mutation was based on the technique of shifted termination assay, which was demonstrated to have a 100% sensitivity and specificity for the detection of BRAF mutation .
Cancer Basket Trials: A Potential Boon For Rare Cancers
NCI-MATCH and ROAR are both known as basket trials. Such clinical trials enroll patients with different types of tumors and assign them to groups, or baskets, based on criteria such as the molecular features of their tumors.
For many rare cancers, it can be challenging to develop clinical trials that recruit enough patients to show a benefit from certain therapies, particularly for treatments that target tumors with uncommon genetic alterations.
Basket trials offer a potential solution to this problem by allowing researchers to efficiently study treatments in multiple rare cancers, according to April Salama, M.D., who directs the melanoma program at the Duke Cancer Institute and co-led the NCI-MATCH substudy testing the dabrafenibtrametinib combination.
Nearly 75% of the patients in the NCI-MATCH substudy experienced a clinically meaningful benefit from the combination therapy, Dr. Salama said. Most of the patients had previously received multiple therapies and had few additional treatment options.
As we learn more about the molecular underpinnings of cancer, will continue to become more common, Dr. Salama predicted. These studies are complicated to conduct, but they may also be one of the best ways to bring new treatment options to the clinic.
You May Like: How To Check Thyroid Gland At Home
Detection Of Ret Rearrangements
Rearrangements of the RET gene were analyzed in 67 human tumor samples by Southern blot analysis. Briefly, 10 μg of DNA was digested separately with EcoRI, HindIII, BamHI, and BglII , electrophoresed in 0.8% agarose gel, and transferred to nylon filters . Hybridization was performed with a 1-kb BamHI-BglII RET-specific probe 32P-labeled using a random oligonucleotide primer kit .
The researchers screening tumors for BRAF mutations and those genotyping for RET/PTC or RAS were blinded to their respective results until all of the experiments were concluded.
Cancers That May Involve Braf Mutations
At the current time, several different types of cancer have been found to harbor BRAF mutations. However, the frequency, as well as the response to BRAF inhibitors, varies.
BRAF mutations are an example of how cancer treatment is changing. In the past, cancers were usually treated according to type . BRAF inhibitors, in contrast, are what are now considered “tumor agnostic” medications.
This means that the drugs may work for different types of cancer . However, the cancer cells must have the same type of mutation responsible for driving the growth of the tumor.
Reading studies about BRAF mutations can be confusing. When the term “BRAF wild-type” or BRAF WT is used to describe a tumor, it refers to a cancer that does not have a BRAF mutation.
Read Also: What Is The Treatment For Low Thyroid
The Braf V600e Mutation Is A Predictor Of The Effect Of Radioiodine Therapy In Papillary Thyroid Cancer
1. NHC Key Laboratory of Carcinogenesis and Hunan Key Laboratory of Translational Radiation Oncology, Hunan Cancer Hospital and the Affiliated Cancer Hospital of Xiangya School of Medicine, Central South University, Changsha, Hunan, China 2. Key Laboratory of Carcinogenesis and Cancer Invasion of the Chinese Ministry of Education, Cancer Research Institute and School of Basic Medicine, Central South University, Changsha, Hunan, China 3. Hunan Key Laboratory of Nonresolving Inflammation and Cancer, Disease Genome Research Center, the Third Xiangya Hospital, Central South University, Changsha, Hunan, China.
Corresponding authors: Prof. Zhaoyang Zeng, Email: zengzhaoyangedu.cn, and Dr. Jin Zhao, Email: 709833789com.
Citation:BRAFJ Cancer
Data Extraction And Quality Assessment
Two reviewers carefully reviewed the full text of the eligible studies and independently extracted relevant information. Data including the names of authors, publication year, country, geographical region or ethnicity, study period, number of patients, BRAF mutation status, recurrence rates, and hazard ratio of recurrences were obtained with a structured data collection form. The NewcastleOttawa scale was used for the assessment of study quality studies with scores of 8 or higher were eligible for inclusion in this meta-analysis.
Read Also: Can You Get Cancer In Your Thyroid
Read Also: Blood Test For Thyroid Levels
Targeting Braf In Thyroid Cancer For Treatment
With the findings that BRAF mutations in PTC, ATC, and other human tumors tend to have more aggressive phenotypes and often become resistant to traditional therapies, developing a therapeutic agent that can selectively target oncogenic BRAF kinase may be of great clinical utility. Multikinase inhibitors, which act on multiple components of the MAPK pathway, have shown great promise in the treatment of malignancies harboring a BRAF mutation. Sorafenib is one such therapeutic agent that targets BRAF, CRAF, VEGF receptors 1 to 3, platelet-derived growth factor receptor, and RET kinases to inhibit tumor proliferation and angiogenesis . Using RNA interference to knock down BRAF in human ATC cell lines, preclinical studies showed the importance of BRAF for intracellular MAPK signaling and proliferation, as tumor growth was significantly inhibited . These findings suggested that BRAF could be an effective target for thyroid cancer treatment. The effect of sorafenib was similar to that of siRNA BRAF knockdown, inhibiting BRAFV600E-mediated intracellular signaling in vitro in xenograft models and in thyroid carcinoma cells, yet having minimal effects on normal thyrocytes .
Detection Of Braf Mutations
Mutations of BRAF reported recently in melanomas and colorectal cancers are confined to exons 11 and 15 . DNA samples were screened by SSCP for mutations within these regions, as well as sequencing of gel-extracted and/or whole-sample PCR products. Primer pairs were designed flanking BRAF exons 11 and 15, respectively. PCR primer sequences were as follows: exon 11: 5â²tctgtttggcttgacttgacttt 3â² and 5â²catgccactttcccttgtagac 3â² and exon 15: 5â²aaactcttcataatgcttgctctg 3â² and 5â²ggccaaaaatttaatcagtgga 3â². Amplifications were carried out for 35 cycles with annealing temperatures optimized for each primer pair. Twenty five-μl PCR reactions were performed on 100 ng genomic DNA, 7.5 pmol of each primer, 100 μm deoxynucleoside triphosphates, 5 μCi dCTP, 1.5 mm MgCl2, Platinum TaqDNA polymerase high fidelity , and buffer. SSCP analysis was performed using a method reported previously . The PCR reaction mixture was diluted in DNA gel-loading buffer , denatured by incubating at 94 C for 5 min, placed on ice, and loaded onto a 0.6% mutation detection enhancement gel solution with 10% glycerol. Gels were run with 0.6à Tris-borate EDTA buffer at 8W for 7â10 h at room temperature. Autoradiography was performed with an intensifying screen at â70°C for 12â24 h. All of the PCR reactions from PTC samples were repeated at least twice.
Read Also: Why Are My Thyroid Levels High
Somatic Braf Mutation In Thyroid Neoplasms
We then sought to analyze BRAF mutation in benign follicular adenomas and papillary thyroid carcinomas using PCR-based MASA to detect the hot-spot BRAF mutation at the T1796 site. A PCR primer with two mismatches at the 3â²-end was used to amplify mutant BRAF, whereas a control primer derived from wild-type BRAF gene that amplifies both wild-type and T1796 mutant BRAF was used as a control. We first tested the feasibility of this method to detect BRAF mutation at T1796 site in well-characterized thyroid tumor cell lines. As shown in B, the BRAF exon 15 was amplified by using the mismatched primer in 4 BRAF-mutant thyroid tumor cell lines but not in 2 wild-type cell lines . A PCR reaction that amplifies BRAF exon 15 was included as a positive control. BRAF exon 15 was amplified in all samples. These results suggest that screening of BRAF mutation using this MASA-PCR is specific, and this approach can be used to rapidly screen BRAF mutation at codon 599 in a large number of tumor samples.
Prevalence Of Braf V600e Mutation In Thyroid Cancer
The BRAF V600E mutation was detected in 51% of conventional PTCs, 24% of FVPTCs, and 1% FTCs .
Multiple tumor samples from 36 patients with conventional PTC were also analyzed for BRAF V600E mutation. In 32 patients with a primary tumor and 1 lymph node metastasis: 13 had BRAF V600E mutation in both samples, 14 had no BRAF V600E mutation in both tumor samples, and 5 had discordant BRAF V600E mutation status . Three patients had their primary tumor and 2 lymph node metastases analyzed: 2 of 3 had BRAF V600E mutation in all the samples, and 1 patient had no BRAF V600E mutation in all the samples. The 1 patient with a primary tumor and 3 lymph node metastases had the BRAF V600E mutation in all the samples.
Also Check: No Specs Thyroid Eye Disease
Is Braf Mutation Hereditary
In most cases, a BRAF mutation identified in cancer developed at some point throughout a persons life. In this situation, the mutation affects only the cells where the change has occurred and cannot be passed on to your children. In a few very rare cases, BRAF mutations can be inherited . If a mutation is present at birth, it could affect multiple cells in the body, causing significant health issues.
Sample Selection And Dna Isolation
In all, 16 patients with anaplastic thyroid carcinoma were identified from a search of the archival surgical pathology files of The Johns Hopkins Hospital between 1985 and 2003. After initial patient identification, all original histologic slides were reviewed by one of us to confirm the diagnosis, and an appropriate block was retrieved for DNA extraction. The paraffin blocks were sectioned, and tissues sections were microdissected to obtain greater than 80% neoplastic cells. When the slides showed an anaplastic thyroid carcinoma arising in association with a well-differentiated thyroid carcinoma, the anaplastic and well-differentiated components were separately collected and analyzed. DNA was extracted using standard protocols as previously published.
Also Check: Different Types Of Thyroid Tests
Don’t Miss: How To Cure Thyroid Problem
Detection Of Ras Mutations
Sixty-seven human tumor samples were analyzed for point mutations in codons 12/13, and 61 of the N-RAS, H-RAS, and K-RAS genes using LightCycler fluorescence melting curve analysis. Briefly, 100 ng of DNA from each tumor was amplified with primers flanking codons 12/13 or 61 of each RAS gene using a hybridization probe format followed by fluorescence melting curve analysis . All of the PCR products that displayed a deviation from normal melting pick were directly sequenced to verify the presence of RAS mutation and detect the exact nucleotide change.
Relationship Between The Brafv600e Mutation And Clinicopathological Features
Among all the patients, 75 cases were positive for the BRAF V600E mutation, and 53 patients carried the wild type BRAF gene, thus the mutation rate was 58.6%. Among the patients with the BRAF V600E mutation, there were 17 males and 58 females among the patients with wild-type BRAF, there were 8 males and 47 females . The median age of patients with the BRAF mutation was 41 years, while the median age of patients with wild-type BRAF was 38 years . The BRAF V600E mutation was closely associated with the high-risk age . There was no significant correlation between the BRAF V600E mutation and lymph node metastasis , distant metastasis , or clinical stage .
You May Like: Best Iodine Supplement For Thyroid
Similar Articles Being Viewed By Others
Carousel with three slides shown at a time. Use the Previous and Next buttons to navigate three slides at a time, or the slide dot buttons at the end to jump three slides at a time.
21 February 2018
Emira Ayroldi, Maria Grazia Petrillo, Carlo Riccardi
volume 96, pages 1620
A Corrigendum to this article was published on 17 April 2007
This article has been
What Gets Stored In A Cookie
This site stores nothing other than an automatically generated session ID in the cookie no other information is captured.
In general, only the information that you provide, or the choices you make while visiting a web site, can be stored in a cookie. For example, the site cannot determine your email name unless you choose to type it. Allowing a website to create a cookie does not give that or any other site access to the rest of your computer, and only the site that created the cookie can read it.
Read Also: How Can I Get Armour Thyroid
Read Also: What Thyroid Tests Should I Ask For
Braf V600e Mutation Status And Thyroid Cancer Phenotype By Histologic Subtype
Comparison of BRAF V600E mutation status with clinical and pathologic factors in patients with PTC and the FVPTC revealed significant associations of BRAF V600E with older age , AMES risk group , and recurrent and persistent disease with a trend towards a higher rate of lymph node metastasis and higher TNM stage . In patients with conventional PTC, BRAF V600E mutation was associated with older age , lymph node metastasis , distant metastasis , higher TNM stage , and recurrent and persistent disease .
TABLE 2. Associations Between the BRAF V600E Mutation and Clinicopathologic Characteristics of Papillary Thyroid Cancer
Prognostic Value Of Braf Mutation In Thyroid Cancer
Whether to treat a PTC patient with radioiodine, and how vigilantly and aggressively to guard against recurrence, are often questions without straightforward clinical answers. Use of BRAF mutation status may help clarify such clinical situations and assist clinical decision making. It is expected that BRAF mutation may also be useful in risk and prognostic evaluation of micro PTC. Although this type of thyroid cancer is generally thought to be indolent and associated with a relatively good prognosis, local and distant metastasis and recurrence do occur, and no specific independent prognostic clinicopathological factors were identified on multivariate analysis for this type of PTC . As BRAF mutation often occurs in micro PTC as well , it would be interesting to investigate BRAF mutation as an independent prognostic factor to help manage these patients more appropriately.
Read Also: What Size Thyroid Nodule Should Be Removed
Features Of Infiltrating Immune Cells In Braf
As risk score, HTR3A and NIPAL4 were associated with the poor prognosis of PTC patients with BRAF mutation, and we further evaluated the correlation between immune cells and the above three factors. We observed that the Tr1, nTreg, iTreg and Tfh cell numbers were increased in the high-NIPAL4 group and that the Tr1, nTreg, iTreg, Th1, Tfh, gamma delta T, and CD4+ T cell numbers were increased in the high-HTR3A group and high-risk group conversely, the Th17 cell number was decreased. In addition, macrophages were increased only in the high-risk group, while CD8+ naive cells decreased only in the high-HTR3A group. The infiltration scores between the low-NIPAL4 and high-NIPAL4 groups, the low-HTR3A group and the high-HTR3A group, and the low- and high-risk groups were all statistically significant . These findings suggested that HTR3A expression and NIPAL4 expression were likely to be involved in BRAF-mutated PTC by interfering with immune cells.
Figure 10 Violin plot showing the compression of each immune cell type in the low/high NIPAL4 groups , low/high HTR3A groups and low/high risk groups . The high-risk/HTR3A/NIPAL4 groups had a higher degree of immune cell infiltration , suggesting that the risk score, HTR3A and NIPAL4 are involved in the prognosis of BRAF-mutated PTC by interfering with immune cells.
What Is The Relationship Between Braf Mutation And Cancer
Some mutations in BRAF cause cancer in combination with additional mutations or other factors. BRAF mutations can also cause cancers to grow more quickly than they would otherwise, either alone or in combination with additional mutations.
The cancers associated with the BRAF gene mutation are not specific to one part of the body or a certain cell type. These cancers include:
- Hairy cell leukemia
- Certain brain cancers, including glioblastoma, pilocytic astrocytoma, and pediatric low-grade glioma
You May Like: How To Reset Thyroid To Burn Fat
Therapeutic Potential Of Inhibiting The Map Kinase Pathway Using Novel Inhibitors In Thyroid Cancer
Although thyroid cancer is usually indolent and curable with the current standard treatments of surgery, often followed by adjuvant radioiodine therapy, there remain many patients whose conditions are incurable, disabling, and even fatal. The most difficult cases, for which there is no effective current treatment, are those that are inoperable and have lost radioiodine avidity. This includes ATC, which is often positive for BRAF mutation . A novel effective treatment is needed desperately for these patients . As activation of the MAP kinase pathway by various genetic alterations, including BRAF mutation, plays a pivotal role in thyroid tumor genesis and progression, efforts targeted at inhibiting this pathway may lead to development of novel effective therapy for thyroid cancer.