Braf Mutation Papillary Thyroid Cancer

Papillary Thyroid Carcinoma Braf Immunopositivity

Next ArticleKaare Nygaard: Surgeon, Scientist, SculptorWhat statement is most accurate regarding papillary thyroid carcinoma?

• a.The most common genetic alteration in papillary thyroid carcinoma involves RAS
• b.Although papillary thyroid carcinomas may be classified into different variants , the behavior and prognosis are similar regardless of variant
• c.Papillary thyroid carcinoma is less common than other types of thyroid carcinoma
• d.The most relevant genetic alterations in papillary thyroid carcinoma involve BRAF, RET, and RAS, are generally mutually exclusive, and are associated with activation of the MAPK pathway

Answer: d. The most relevant genetic alterations in papillary thyroid carcinoma involve BRAF, RET, and RAS, are generally mutually exclusive, and are associated with activation of the MAPK pathway

Effect Of Braf V600e Mutation On Ptmc Recurrence

During the median follow-up period of 75 months , tumor recurrence occurred in 2.6% patients. The recurrence rate was 2.9% and 2.1% for BRAF mutation-positive and -negative patients, respectively , with an unadjusted HR of 1.48 . After adjustments for age, sex, tumor size, LNM, ETE, multifocality, surgical type, and RAI treatments, the effect of the BRAF mutation on tumor recurrence remained insignificant, with an HR of 1.05 . The KaplanMeier survival curve also showed no significant difference between BRAF mutation-positive and -negative patients in regard to recurrence-free survival .

Investigation Of The Potential Functions And Pathways Associated With The Time In Braf

To elucidate TIME-related potential biological functions and pathways, Gene Ontology term and KEGG pathway enrichment analyses were performed on the above 617 DEGs. Based on the Metascape database, we examined a total of 2084 GO assignments, including 1750 BPs, 194 MFs, and 140 CCs. In the BP category, most genes were involved in T-cell activation, regulation of lymphocyte activation, immune effector processes, leukocyte differentiation and mononuclear cell differentiation. In the MF category, most genes may play roles in immune receptor activity, cytokine activity, extracellular matrix structural components, receptor ligand activity and signaling receptor activator activity. In the CC category, most genes were associated with the external side of the plasma membrane, side of the membrane, extracellular matrix, external encapsulating structure and collagen-containing extracellular matrix. The top 10 significantly enriched GO terms are shown in Figure 4A. Furthermore, KEGG pathway analysis revealed that 84 pathways, such as cytokinecytokine receptor interaction, chemokine signaling pathway, primary immunodeficiency and cell adhesion molecules , were significantly enriched . According to the p values in the GO and KEGG enrichment analyses, immune-related activities were the most significantly enriched terms and pathways, consistent with the TIME phenotype. Thus, these results provided key insights into the mechanism of BRAF-mutated PTC from the perspective of the TIME.

Read Also: Best Thyroid Medication Weight Loss

Study Design Specimen And Information Collection

As a total, 393 archival specimens were collected: 323 were PTCs and are the object of the present study. Additional 70 specimens that included normal thyroid tissue and colloid goiters, follicular adenomas and carcinomas, and anaplastic carcinomas were also examined at the same time.

Surgery medical records provided the information regarding patients and tumors . Clinical staging of thyroid cancer was classified according to the Tumor-node-metastasis classification . Persistent disease was evaluated in 118 patients, with a 2- to 4-year follow-up.

Information regarding environmental goitrogens were obtained by previous scientific publications regarding the presence of these goitrogens in different areas of Sicily .

Tumor Testing Vs Liquid Biopsy

Historically, testing done on a sample of tissue obtained via a biopsy has been the gold standard. Unfortunately, tissue biopsies are invasive and may not always be possible.

In recent years, a simple blood test that looks for fragments of tumor DNA in the blood has offered an additional option for genomic testing. Liquid biopsies have been found to be comparable to tissue biopsies in some cases, though many oncologists believe that the ideal is to do genomic testing on both tissue and blood samples.

Don’t Miss: Thyroid And Menopause Weight Gain

Clinical Significance Of Peak1 Expression And Braf V600e Mutation In Papillary Thyroid Cancer

• 1Department of Endocrinology, The Affiliated Hospital of Qingdao University, Qingdao, China
• 2Department of Pathology, The Affiliated Hospital of Qingdao University, Qingdao, China
• 3Department of Nuclear Medicine, The Affiliated Hospital of Qingdao University, Qingdao, China
• 4Department of Otorhinolaryngology, The Affiliated Hospital of Qingdao University, Qingdao, China
• 5Department of General Surgery, The Affiliated Hospital of Qingdao University, Qingdao, China

Papillary thyroid cancer is a common endocrine malignancy, which accounts for 8085% of all thyroid cancers. Overall, the prognosis of PTC is very good. However, for those with tumor invasion, metastasis or refractory PTC, the prognosis of these patients is poor and eventually die from postoperative recurrence and metastasis . Therefore, predicting the prognosis of papillary thyroid carcinoma and customizing individualized treatment programs have become topics of concern for clinicians.

Links between PEAK1 expression and the clinicopathological characteristics in PTC patients were determined Positive PEAK1 expression was associated with TNM stage, lymph node metastasis, extrathyroidal Invasion and high ATA risk, but not related with persistence/recurrence.

TABLE 1. Clinical and pathologic characteristics of PEAK1 expression and BRAFV600E expression status in PTCs.

Braf Pcr And Sequencing

The most common T1799A transversion mutation was studied by direct sequencing after PCR amplification of exon 15 of the BRAF gene. Fifty nanograms of DNA was amplified using the following primers: forward 5TGTAAAACGACGGCCAGTCA TAA TGC TTG CTC TGA TAG GA 3 reverse 5 AGCGGATAACAATTTCACACAGGC CAA AAA TTT AAT CAG TGG A 3. The PCR products were run on a 1.5% agarose gel to determine the quality of the PCR product. The PCR products before sequencing were treated with Exonuclease to eliminate excess primers and Shrimp Alkaline Phosphatase to dephosphorylate excess deoxynucleotides. Sequencing was performed with a colorimetric method using the BigDye Terminator v3.1 Cycle Sequencing Kit on an ABI PRISM 3730 genetic analyzer .

Don’t Miss: Are Home Thyroid Tests Accurate

Braf V600e Mutation Related Molecular Events In Ptc

The most common genetic alterations in PTCs include BRAF mutation, RAS mutation, and RET/PTC rearrangement which mainly involve in the RAS/BRAF/MAPK signal pathway. Interesting, these molecular alterations are exclusive in PTC patients, suggesting that each of them alone is sufficient for malignant transformation of thyroid cells. BRAF V600E mutation strongly increases BRAF kinase activity by eliciting ERK1/2 phosphorylation which is 480-fold higher than wild type BRAF . The markedly increased ERK1/2 phosphorylation in BRAF V600E mutation mainly attributed to a negatively charged residue adjacent to the phosphorylation site at T598 and mimicking phosphorylation at Thr598 and Ser601 residues .

The activation of the mitogen-activated protein kinase pathway in thyroid cancer by mutant BRAF. The most common genetic alternation in papillary thyroid cancer, BRAF mutation, stimulates constitutive signaling which bypasses the need for extracellular mitogenic signals. Subsequently phosphorylation of downstream MER1/2 and ERK1/2 results in transcriptional regulation of various genes which are involved in cell proliferation, differential, survival, tumorigenesis, and the process of EMT.

Role Of Braf Mutations In Melanoma Lung Cancer And More

Oliver Eng, MD, is a double board-certified surgeon and surgical oncologist and an Assistant Professor of Surgery at the University of Chicago.

• Frequently Asked Questions

BRAF mutations are DNA changes in some cancer cells that can be treated with newer targeted therapies.

BRAF mutations are found in roughly half of melanomas. Medications that target these mutations have significantly improved the survival rates of metastatic melanoma. BRAF mutations are also present in some non-small cell lung cancers, colon cancers, and other tumor types.

Verywell / Jessica Olah

Genomic testing of tumors can look for DNA alterations and determine if the cancer will respond to drugs targeting mutations.

This article looks at what a BRAF mutation is and its frequency in different types of cancer. It also looks at testing, treatment options, and recent advances.

Read Also: Best Thyroid Diet To Lose Weight

Targeting Braf Signaling Pathway As Therapeutic Target To Treat Thyroid Cancer

The BRAF mutation leads to the activation of BRAF kinase and stimulation of MAPK pathway, which is crucial for tumor initiation of PTCs. Many studies demonstrated the role of MAPK signaling pathway in thyroid tumorigenesis and therefore BRAF has become an attractive target . Several molecule inhibitors of BRAF have been developed including sorafenib, PLX4032, RAF265, PLX4720, and XL281 with different selectivity . Indeed, encouraging results with the BRAF inhibitors sorafenib and PLX4032 were recently reported in clinical trials with malignant melanoma which has a high prevalence of BRAF mutations . These drugs showed markedly inhibition of cell proliferation, survival, motility, and invasion in vivo and in vitro. PLX4032, a compound of selectively targeted BRAF V600E, can effectively inhibit the proliferation of PTC cell lines bearing BRAF mutation . However, incomplete inhibition of ERK activation by PLX4032 was also revealed in comparison with the MEK inhibitor PD0325901 by which ERK activation was fully inhibited. The disabled feedback mechanisms and wild-type BRAF proteins may contribute to the incomplete inhibition of ERK activation. Moreover, recent studies suggested that BRAF activates nuclear factor B and this pathway is MEK-independent .

Braf Mutationone Of The Most Frequent Events In The Pathogenesis Of Ptc

The beginning of 2000 marked the interest in BRAF gene mutation in thyroid cancer. At that time studies on the role of the mutation in other cancers had been already known . BRAF gene is localized on chromosome 7.

It codes cytoplasmic serine/threonine kinase which influences the activation of mitogen-activated pathway kinases . BRAF gene mutations activate the MAPK pathway resulting in the intensity of cellular proliferation, inhibition of differentiation and apoptosis. In other words, they lead to a loss of control over the cellular cycle, initiating the development of malignancy as a result. BRAF mutation is one of the most prevalent molecular events in the pathogenesis of PTC in adults . Point mutation T1799A is the most common and the most examined mutation of all BRAF gene mutations. It results in the exchanging valine to glutamate at residue 600 near the catalytic center of the protein . Finding this mutation is possible not only in postoperative material but also, which is more significant, in fine needle aspiration biopsy material and may be known at diagnosis of PTC .

Don’t Miss: Can You Die Of Thyroid Cancer

Time Scores Were Associated With Pathological Stage In Braf

To determine the relationship between TIME scores and clinical features, the neoplasm disease stage , tumor stage , metastasis stage , lymph node stage and progression-free survival of the BRAF mutated cohort were analyzed. Although the TIME scores had no significant correlations with PFS , the StromalScore was correlated with T classification , and the ESTIMATEScore was significantly associated with stage and T classification . These results implied that TIME scores were correlated with pathological stages in patients with BRAF-mutated PTC.

Figure 2 Correlation of TIME scores with clinicopathological staging characteristics. The StromalScore was correlated with the T classification of the TNM staging system , and the ESTIMATEScore was significantly associated with the stage and T classification . ImmuneScore had no correlation with the tumor stage or the T classification, M classification, or N classification of the TMN staging system .

Characteristics Of Ptc Datasets

The mRNA-seq data, somatic mutation data and clinical information of PTC patients were downloaded from the TCGA Genomic Data Commons portal. The clinical data included sex, age, radiotherapy history, metastasis stage, lymph node stage, tumor stage and neoplasm disease stage. According to the BRAF gene mutation status, 494 PTC patients were assigned to either the BRAF mutation group or the BRAF wild-type group . Patients with other clinically relevant nonsilent gene mutations were not included in the BRAF wild-type group.

Also Check: What Are The Signs Of Thyroid Cancer Returning

Braf And Nras Mutational Frequency

The frequency of BRAF and NRAS mutations varied among the different histopathologic subtypes of PTC. In cPTC and PTMC subtypes, BRAF mutations were predominant, while NRAS were less common. Conversely, in PTMC-FV and PTC-FV, NRAS mutations were more common than BRAF mutations with statistical significance of p< 0.0001. The BRAFV600E mutation subtype comprised 98.0% of the total BRAF mutated PTC cases followed by BRAFV600M identified in two cases: one cPTC case and a second cPTC case with a concomitant BRAFV600E and V600M. The NRAS mutational subtypes included c.182A> G c.181C> A , c.34G> A and c.38G> A . Concomitant BRAF and NRAS mutations were detected in five PTC cases inclusive of one cPTC, two PTMC and two PTMC-FV cases. KRAS mutations were detected in only 4 out of 246 cases tested therefore, no further statistical analysis was performed. No mutations were detected in all adenomatous goiter cases .

Immune Cell Infiltration Analysis In Braf

ImmuCellAI is a scientific tool capable of estimating abundance and InfiltrationScore for up to 24 immune cell types from gene expression datasets . There were 18 T-cell subtypes and 6 other immune cell types , constituting 24 types of immune cells. Gene expression profiles of the BRAF-mutated PTC cohort were used in immune cell infiltration analysis. Two-way ANOVA was used to calculate the associations between prognostic genes or risk score and immune cell infiltration.

Don’t Miss: What Are Some Thyroid Medications

Features Of Infiltrating Immune Cells In Braf

As risk score, HTR3A and NIPAL4 were associated with the poor prognosis of PTC patients with BRAF mutation, and we further evaluated the correlation between immune cells and the above three factors. We observed that the Tr1, nTreg, iTreg and Tfh cell numbers were increased in the high-NIPAL4 group and that the Tr1, nTreg, iTreg, Th1, Tfh, gamma delta T, and CD4+ T cell numbers were increased in the high-HTR3A group and high-risk group conversely, the Th17 cell number was decreased. In addition, macrophages were increased only in the high-risk group, while CD8+ naive cells decreased only in the high-HTR3A group. The infiltration scores between the low-NIPAL4 and high-NIPAL4 groups, the low-HTR3A group and the high-HTR3A group, and the low- and high-risk groups were all statistically significant . These findings suggested that HTR3A expression and NIPAL4 expression were likely to be involved in BRAF-mutated PTC by interfering with immune cells.

Figure 10 Violin plot showing the compression of each immune cell type in the low/high NIPAL4 groups , low/high HTR3A groups and low/high risk groups . The high-risk/HTR3A/NIPAL4 groups had a higher degree of immune cell infiltration , suggesting that the risk score, HTR3A and NIPAL4 are involved in the prognosis of BRAF-mutated PTC by interfering with immune cells.

Quantification Of Gene Expression Level

Human reference genome and gene model annotation files were downloaded from UCSC. Index of the reference genome was built and paired-end clean reads were aligned to the reference genome using HISAT2 with default parameters. RSeQC was used to measure gene expression abundance as reads per kilobase per million mapped reads .

You May Like: How To Lose Weight With Thyroid Nodules

Prevalence Of Tert Promoter And Braf V600e Mutations In Ptc

Among 7797 patients with PTC, TERT promoter mutations were found in 87 , of which the C228T mutation was observed in 76 and the C250T in 11 . Meanwhile, the BRAF V600E mutation was observed in 6546 patients . The coexistence of BRAF and TERT promoter mutations was identified in 70 patients , while 1234 had no mutations .

What Does This Case Report Add

We identified concurrent BRAF mutation and TSHR polymorphism for the first time in a case of hyperfunctioning malignant thyroid nodule.

The findings from the present case and our literature search suggest that concomitant activation of oncogenes cascade) plays an important role in the carcinogenesis for hyperfunctioning thyroid nodules.

Also Check: Castor Oil Pack For Thyroid

Relationship Between The Brafv600e Mutation And Clinicopathological Features

Among all the patients, 75 cases were positive for the BRAF V600E mutation, and 53 patients carried the wild type BRAF gene, thus the mutation rate was 58.6%. Among the patients with the BRAF V600E mutation, there were 17 males and 58 females among the patients with wild-type BRAF, there were 8 males and 47 females . The median age of patients with the BRAF mutation was 41 years, while the median age of patients with wild-type BRAF was 38 years . The BRAF V600E mutation was closely associated with the high-risk age . There was no significant correlation between the BRAF V600E mutation and lymph node metastasis , distant metastasis , or clinical stage .

Detection Of Ras Mutations

Sixty-seven human tumor samples were analyzed for point mutations in codons 12/13, and 61 of the N-RAS, H-RAS, and K-RAS genes using LightCycler fluorescence melting curve analysis. Briefly, 100 ng of DNA from each tumor was amplified with primers flanking codons 12/13 or 61 of each RAS gene using a hybridization probe format followed by fluorescence melting curve analysis . All of the PCR products that displayed a deviation from normal melting pick were directly sequenced to verify the presence of RAS mutation and detect the exact nucleotide change.

You May Like: Stop The Thyroid Madness Com

A Critical Approach To The Practical Application Of The Analysis Of Braf Mutation As An Independent Molecular Prognostic And Predictive Factor

The strongest argument against using BRAF mutation analysis as an independent prognostic and predictive risk factor in patients with PTC is its high prevalence whereas the risk of persistent disease or recurrence is related to about 30% of population .

At present, it seems that BRAF mutation is one of the factors influencing the prognosis and it should be analyzed in correlation with other prognostic factors .

The most recent revision of ATA recommendations is also related to it.

Despite the fact that previously Prescott et al. demonstrated that adding BRAF status to different commonly applied risk scales improves the possibility of the proper patient classification . It allows for a better prediction related to the risk of relapse. The 5-year cumulative recurrence incidence observed by these authors was 20% in BRAF vs. 8% in BRAF patients. BRAF was associated with the time to recurrence when it was added to the following risk-scales: AMESHR 2.43, MACISHR 2.46, TNMHR 2.51, ATA recurrence risk categoryHR 2.44.

Due to a lack of evident confirmation of a direct influence of mutation on the increase in relapse risk, ATA most recent recommendations do not indicate a routine application of BRAF status for initial risk stratification in differentiated thyroid cancer. However, due to the fact that a clinician may possess such knowledge, ATA demonstrates the continuous risk scale for the assessment of the risk of relapse, considering BRAF and/or TERT status .